Both ShortStack and miRdeep2 are programs for identifying both known and novel miRNAs from a dataset based on an input database of known miRNAs and on expected miRNA size and precursor structures. However, they’re giving pretty different output counts. Today I want to look at how much overlap there is in identified miRNAs between the two.
Rendered code:
Summary
| Species | Identified miRNAs | miRNAs with database match | Database matches *not* classified as miRNA | # of ShortStack miRNAs that are also classified as miRNA by miRdeep2 |
| A.pulchra | 38 | 24 | 44 | 36 |
| P.evermanni | 46 | 9 | 27 | 30 |
| P.meandrina | 36 | 9 | 20 | 27 |
I used bedtools intersectBed to find shared sequences in the ShortStack and miRdeep2 mature miRNA output files.
Notes
Interestingly, in all three of the species I saw an example of an miRNA identified by ShortStack that matched two loci identified as miRNAs by miRdeep2.
In one of these examples (A.pulchra), the mature miRNA sequences for both the miRdeep2 miRNAs were identical, but the precursor sequences were different – could this be an example of two different precursors that are processed into the same miRNA?
NC_058072.1_Acropora_millepora_isolate_JS-1_chromosome_7_Amil_v2.1_whole_genome_shotgun_sequence_295614 12623.6 - 24755 24435 0 320 no - tca-miR-11646-3p_MIMAT0045620_Tribolium_castaneum_miR-11646-3p - - ugggugucaucuauuauguuuu aacauaaaagauggcacc ugggugucaucuauuauguuuuugcuuguuaaaacauaaaagauggcacc NC_058072.1_Acropora_millepora_isolate_JS-1_chromosome_7_Amil_v2.1_whole_genome_shotgun_sequence:19030617..19030667:+
NC_058072.1_Acropora_millepora_isolate_JS-1_chromosome_7_Amil_v2.1_whole_genome_shotgun_sequence_295613 1.1 - 24449 24435 14 0 no - tca-miR-11646-3p_MIMAT0045620_Tribolium_castaneum_miR-11646-3p - - ugggugucaucuauuauguuuu aauguaacaaaauugacggccaga aauguaacaaaauugacggccagaagccguacguauguagaaaauguggggugagugccugggugucaucuauuauguuuu NC_058072.1_Acropora_millepora_isolate_JS-1_chromosome_7_Amil_v2.1_whole_genome_shotgun_sequence:19030558..19030639:+
mature miRNA sequences for these two loci:
ugggugucaucuauuauguuuu
ugggugucaucuauuauguuuu
precursor miRNA sequences for these two loci:
ugggugucaucuauuauguuuuugcuuguuaaaacauaaaagauggcacc
aauguaacaaaauugacggccagaagccguacguauguagaaaauguggggugagugccugggugucaucuauuauguuuuIn the other two cases (P.evermanni and P.meandrina) the pairs of loci had very similar precursor sequences and reversed mature and star sequences! In other words, the mature miRNA sequence for one is almost identical to the miRNA* sequence of the other, and vice versa!
P. evermanni:
Porites_evermani_scaffold_334_234019 5.6 - 969 686 0 283 yes - gga-miR-12259-5p_MIMAT0050009_Gallus_gallus_miR-12259-5p - - ugcagguacaguuauaaggu accuuauaacuguaccugccaa ugcagguacaguuauaagguccccuugguggaccuuauaacuguaccugccaa Porites_evermani_scaffold_334:153573..153626:-
Porites_evermani_scaffold_334_233889 5.5 - 111 96 0 15 yes - cpi-miR-9592-5p_MIMAT0037980_Chrysemys_picta_miR-9592-5p - - gaccuuauaacuguaccugc gcagguacaguuauaaggucc gcagguacaguuauaagguccaccaaggggaccuuauaacuguaccugc Porites_evermani_scaffold_334:153576..153625:+
mature miRNA sequences for these two loci:
ugcagguacaguuauaaggu
gaccuuauaacuguaccugc
miRNA* sequences for these two loci:
accuuauaacuguaccugccaa
gcagguacaguuauaaggucc
precursor miRNA sequences for these two loci:
ugcagguacaguuauaagguccccuugguggaccuuauaacuguaccugccaa
gcagguacaguuauaagguccaccaaggggaccuuauaacuguaccugcP. meandrina:
Pocillopora_meandrina_HIv1___Sc0000000_1750 6153 - 12060 11275 0 785 yes - hsa-miR-2117_MIMAT0011162_Homo_sapiens_miR-2117 - - uguucucucugcaguaagcaugu augcuugcuguaaagagaacuug uguucucucugcaguaagcauguuuugacaugcuugcuguaaagagaacuug Pocillopora_meandrina_HIv1___Sc0000000:818048..818100:+
Pocillopora_meandrina_HIv1___Sc0000000_34562 10 - 11 9 0 2 yes - egr-miR-153-5p_MIMAT0037428_Echinococcus_granulosus_miR-153-5p - - augcuuacugcagagagaacaug aaguucucuuuacagcaagcaugucaaa aaguucucuuuacagcaagcaugucaaaacaugcuuacugcagagagaacaug Pocillopora_meandrina_HIv1___Sc0000000:818046..818099:-
mature miRNA sequences for these two loci:
uguucucucugcaguaagcaugu
augcuuacugcagagagaacaug
miRNA* sequences for these two loci:
augcuugcuguaaagagaacuug
aaguucucuuuacagcaagcaugucaaa
precursor miRNA sequences for these two loci:
uguucucucugcaguaagcauguuuugacaugcuugcuguaaagagaacuug
aaguucucuuuacagcaagcaugucaaaacaugcuuacugcagagagaacaugCould this just be a case of miRdeep2 incorrectly distinguishing the mature and star sequences for one of these loci?